eduzhai > Applied Sciences > Engineering >

According to the Binary Number Base System, Are the Square Roots of Two Numbers also Significant in Biochemistry?

  • KanKan
  • (0) Download
  • 20210221
  • Save

... pages left unread,continue reading

Document pages: 8 pages

Abstract: According to Quantum Perspective Model, this article researches whether there is a link between the square root of two numbers and the genetic codes. At first, when the digits of the square root of two numbers after the comma are converted from decimal (10) number base system to binary (2) number base system, it corresponds to nucleotide bases. Secondly, the results obtained by this way are expressed as nucleotide bases (A, T, C, G, and U): (A) Adenine, (T) Thymine, (C) Cytosine, (G) Guanine, (U) Uracil. From this point of view, when the first two hundred digits of the square root of two numbers after the comma were calculated. Thirdly, the search result is similar to DANIO RERIO, and even Timema, after the NCBI (National Biotechnology Information Center) searched this sequence [GGATGTCTATTGAGTGACAA]. Fourthly, the genetic codes of Zebra fish have been proven to be very similar to human genetic codes. Lastly, Even Timema reproduces asexually. From this perspective not only the square root of two numbers is irrational number but also Timema has abnormal sexual reproduction. In sum, the relationship between the square root of two in mathematical science and the genetic codes also shed lights on Biochemistry.

Please select stars to rate!

         

0 comments Sign in to leave a comment.

    Data loading, please wait...
×
save success