eduzhai > Applied Sciences > Engineering >

What Is the Meaning of the Square Root of the Number Three in Biochemistry?

  • KanKan
  • (0) Download
  • 20210221
  • Save

... pages left unread,continue reading

Document pages: 8 pages

Abstract: According to Quantum Perspective Model, this article researches whether there is a link between the square root of three numbers and the genetic codes. At first, when the digits of the square root of three numbers [1] after the comma are converted from decimal (10) number base system to binary (2) number base system, it corresponds to nucleotide bases. Secondly, the results obtained by this way are expressed as nucleotide bases (A, T, C, G, and U), (A) Adenine, (T) Thymine, (C) Cytosine, (G) Guanine, (U) Uracil. From this point of view, when the first three hundred and sixty digits of the square root of the two numbers after the comma are calculated, the gene sequence is obtained as follows: [GGATGACTACGGGTTTAGAAA]. Thirdly, the search result is similar to DENTICLE HERRING, after the NCBI (National Biotechnology Information Center) searched this sequence. Fourthly, the genetic codes of bony fish were found to be similar to human genetic codes. In summary, with these results, the link between the square root of three in mathematical science and the genetic codes in biochemistry was determined.

Please select stars to rate!

         

0 comments Sign in to leave a comment.

    Data loading, please wait...
×
save success